RNA and Protein Syntheis

Get Started. It's Free
or sign up with your email address
Rocket clouds
RNA and Protein Syntheis by Mind Map: RNA and Protein Syntheis

1. 1. Differences and similarities of DNA and RNA video : https://www.youtube.com/watch?v=UbiF6mQxCoM

2. 2 . What are the similarities and differences of the three types of RNA? video : https://www.youtube.com/watch?v=gB4QHaOeKz8

3. 3 . Where does transcription occur and why must it occur here? video http://study.com/academy/lesson/transcription-of-messenger-rna-mrna-from-dna.html

4. 5 What is the end product of translation? image :

5. 6 . What enzyme is responsible for a copy of RNA made from DNA? image :

6. 7 . What is the term for a nucleotide triplet?

6.1. codons

7. 8 . Transcribe and translate the mRNA strand: CGAUGGGAUCGUUAGCUAGCAGCUAGCG

7.1. GCTACCCTAGCAATCGATCGTCGATCGC

8. What is meant by gene expression ? image :

9. 10 If a segment of DNA is changed, replacing one base with another, what is this called? What if the base was removed all together?

9.1. mutation : image

10. 11 . What could be the result of a mutation? Are all mutations detrimental (bad)? image :

10.1. no not all mutations are bad , they are either strickly harmful ,strickly helpful , or neautral

11. 12 . Compare and contrast (using a Venn diagram or T-Chart) the processes of DNA replication and Transcription. image :

12. Photosynthesis & Cellular Respiration

12.1. 21 . What is the equation for photosynthesis? image :

12.2. 22 . Where does photosynthesis take place?

12.2.1. Photosynthesis takes place inside plant cells in small things called chloroplasts image :

12.3. 23. What are the two parts of photosynthesis? image :

12.4. 24 . Where does each of the processes above occur?

12.4.1. light dependent reactions :thylakoid membranes

12.4.2. independent reactions /calvin cycle : stroma of the chloroplasts

12.5. 25 . How are these two processes in photosynthesis related and dependent on one another?

12.5.1. Related : Light dependent reactions produce ATP and NADPH which are both neccessary for the calvin cycle .

12.5.2. Different : light dependent reactions happen in the thylakoid membrane and independent reactions occur in the stroma

12.5.3. independent reactions uses the ATP and NADPH which dependent reactions produce .

12.6. 26. What is the equation for cellular respiration? image :

12.7. 27 .What are the parts of cellular respiration?

12.7.1. video : https://www.youtube.com/watch?v=hZUc5KndgyE

12.8. 28 . What part of cellular respiration could not occur if there was no oxygen present? What would happen instead?

12.8.1. Cellular respiration can occur without oxygen , it is known as anaerobic .

12.9. 29 . How are photosynthesis and cellular respiration related?

12.9.1. Photosynthesis is the process whereby carbon dioxide and water react, using energy from sunlight, to produce glucose and oxygen. In cellular respiration, the glucose combines with oxygen to produce carbon dioxide.

12.10. What molecule represents energy produced in cellular respiration?

12.10.1. ATP

12.11. What molecule represents energy produced in cellular respiration?

12.11.1. sunlight

13. Cells and Biochemistry

13.1. 32 . What are the levels of organization? Explain each level and how it differs from the others

13.1.1. Atom : basic unit of matter

13.1.2. Molecules : group of atoms held together by bonds

13.1.3. Organelle: structure within cell that performs specific functions

13.1.4. Cell ; most basic unit of life

13.1.5. Tissue : group of similar cells that perform a specific function

13.1.6. Organ : a structure of several types of tissue that form a functional unit

13.1.7. Organism : independent living thing

13.2. 33. What is the smallest level of organization that can perform life functions?

13.2.1. Atoms/ image :

13.3. 34 . What are the characteristics of life? Give an example of each.

13.3.1. Made of one or more cells : organisms

13.3.2. Displays organization: anteater’s snout

13.3.3. Grows and develops : bullfrog tadpole grows up to a frog

13.3.4. Reproduces : humans reproduce by having children

13.3.5. Responds to stimuli : gazelle running away from a hungry cheetah

13.3.6. Requires energy : a squirrel eats berries

13.4. 35 . Explain how a rock cannot be considered alive.

13.4.1. Rocks can be considered not alive because it doesn’t maintain any of the characteristics of life .

13.5. 36 .What is a monomer?

13.5.1. A monomer is a molecule that can be bonded to other identical molecules to form a polymer. image :

13.6. 37 . What is a polymer?

13.6.1. A polymer is a substance that has a molecular structure consisting chiefly or entirely of a large number of similar units bonded together / image :

13.7. 38 . What is the reaction that forms polymers?

13.7.1. Condensation or dehydration synthesis

13.8. 39 .What is the reaction that breaks polymers?

13.8.1. Hydrolysis

13.9. 40 .What are the four types of biological molecules (macromolecules) discussed in class?

13.9.1. .

13.9.1.1. Carbohydrates , lipids , proteins , and nucleic acids .

13.10. 41What are the monomers for each of the types of biological molecules listed above?.

13.10.1. Carbohydrates - monosaccharides. Lipids - glycerol and fatty acids. Nucleic acids - nucleotides. Proteins - amino acids.

13.11. 42 .Explain the importance of surface area to volume ratio for a cell.

13.11.1. The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume

13.12. 43 . Which cell would be most efficient at absorbing nutrients? A cell with a 8:1 surface area to volume ratio or a cell with a 5:1 surface area to volume ratio? Why?

13.12.1. A cell with a 5:1 ratio because as the surface area to the volume ratio gets smaller

13.13. 44 Which elements (types of atoms) are found in abundance in living organisms? .

13.13.1. Hydrogen , nitrogen , carbon , and oxygen .

13.14. 45 Which element is important when considering if something is “organic”?.

13.14.1. carbon