Biology Fall Semester Final Study Map

Jetzt loslegen. Gratis!
oder registrieren mit Ihrer E-Mail-Adresse
Biology Fall Semester Final Study Map von Mind Map: Biology Fall Semester Final Study Map

1. RNA & Protein Synthesis

1.1. Similarities and Differences between DNA and RNA

1.1.1. DNA has deoxyribose sugar, it is double stranded, and contains thymine while RNA has ribose sugar, single stranded, and has Uracil. They both are a nucleic acid and contain adenine, phosphate, guanine, cytosine.

1.2. What are the similarities and differences of the three types of RNA?

1.2.1. http://study.com/academy/lesson/differences-between-rna-and-dna-types-of-rna-mrna-trna-rrna.html

1.3. Where does transcription occur and why must it occur here?

1.3.1. Through transcription, the DNA code is transferred to mRNA in the nucleus and this happens because it is the first step of the central dogma which involves the synthesis of mRNA from DNA in transcription.

1.4. Where does translation occur?

1.4.1. It occurs in the cytoplasm.

1.4.1.1. It occurs in the cytoplasm.

1.5. What is the end product of translation?

1.5.1. Translation occurs when the end of the mRNA connects to the ribosome, the code is read and translated to make a protein through the process called translation.

1.6. What enzyme is responsible for a copy of RNA made from DNA?

1.6.1. The enzyme RNA polymerase is responsible for a copy of RNA made from DNA

1.7. What is the term for a nucleotide triplet?

1.7.1. The term for a nucleotide triplet is codons

1.8. Transcribe and translate the mRNA strand:

1.8.1. Transcribe: CGATGGGATCGTTAGCTAGCAGCTAGCG Translate: GCUACCCUAGCAAUCGAUCGUCGAUCGC

1.9. What is meant by gene expression?

1.9.1. The production of mRNA is known as gene expression. Genes that do not produce mRNA and do not contribute to the phenotype are not being expressed.

1.10. If a segment of DNA is changed, replacing one base with another, what is this called? What if the base was removed all together?

1.10.1. this is called genetic mutation. If the base was removed all together, it’s referred to as base excision.

1.11. What could be the result of a mutation? Are all mutations detrimental (bad)?

1.11.1. Some mutations don't have any noticeable effects organisms.

1.12. Compare and contrast the processes of DNA replication and Transcription.

1.12.1. DNA Replication Both Transcription -double stranded -involves DNA polymerase -base pair : A-T, G-C -the purpose of replication is to conserve the entire genome for next generation. -the end result is two daughter cells. -Processes use DNA as the template. -Synthesis directions are from 5´- 3´. -Phosphodiester bonds are formed. -single stranded -involves RNA polymerase -base pair : A-U, T-A, G-C -the purpose of transcription is to make RNA copies of individual genes that the cell can use in the biochemistry. -the end result is a RNA molecule.

2. DNA and Cell Division

2.1. What are the three parts of a nucleotide?

2.1.1. The three components of a nucleotide are a nitrogenous base, a sugar and a phosphate group.

2.2. What is the role of DNA

2.3. Explain the process of DNA replication. Use the following terms in your explanation: Free floating nucleotides, unzip, DNA Helicase, complementary base pairing, semiconservative replication.

2.3.1. First helicase begins to break the hydrogen bonds between nitrogen bases. Next free floating nucleotides pair up with exposed nitrogen bases. DNA polymerase attach the free-floating nucleotides to the exposed nitrogen bases. Then two new molecules of dna are created. The complementary base pairings pair up to allow the process to take place. Semiconservative replication would produce two copies that each contained one of the original strands and one new strand, both in which are unzipped.

2.4. What are the two parts of the cell cycle? Explain what happens in each part.

2.5. What are the phases of mitosis?

2.5.1. The phases of Mitosis is Prophase, Metaphase, Anaphase, Telophase

2.6. What is the purpose of cell division?

2.6.1. Cell division has three purposes for an organism: reproduction, growth and maintenance.

2.7. If cell division occurs unchecked, what could result?

2.7.1. If cell division occurs unchecked, diseases can occur as well as injuries.

2.8. Explain the relationship between the following: Chromosome, chromatin, gene, nucleotide

2.8.1. A nucleotide is a building block to DNA. The DNA contains genes, which are located on individual chromosomes and chromatin is a single strand of DNA wrapped around a protein. During the process of cell division and DNA replication, chromatin are copied and then combined into whole chromosomes.

3. Photosynthesis and Cellular Respiration

3.1. What is the equation for photosynthesis? Label each reactant and product in this equation.

3.1.1. In photosynthesis, there is 6 carbon dioxide plus 6 water molecules with light energy it equals 6 carbon dioxide and glucose. 6CO2 + 6H2O + light energy = C6H12O6 + 6O2.

3.2. Where does photosynthesis take place?

3.3. What are the two parts of photosynthesis?

3.3.1. The two parts of photosynthesis are light dependent reactions and light independent reactions.

3.4. Where does each of the processes above occur?

3.4.1. Light dependent reactions occur in the thylakoid membrane during the daytime, when light energy is captured and pushed to be made into ATP while the light independent reactions occur in the stroma and a process occurs when ATP is used to make glucose (calvin cycle).

3.5. How are these two processes in photosynthesis related and dependent on one another?

3.5.1. The two processes are related and dependent on each other because in the light dependent reactions light energy is captured and made into ATP, and with that ATP in the light independent reaction, that ATP is used to make glucose during the Calvin Cycle.

3.6. What is the equation for cellular respiration?

3.6.1. The equation for cellular respiration is C6H12O6 + 6O2 -> yields -> 6CO2 + 6H2O + e- +36-38 ATP's

3.7. What are the parts of cellular respiration?

3.7.1. The stages of the Cellular Cycle are glycolysis, the Krebs Cycle, and the Electron Transport Chain

3.8. What part of cellular respiration could not occur if there was no oxygen present? What would happen instead?

3.8.1. The beyond the Krebs Cycle would not occur if there was no oxygen present. In this case pyruvate, instead of entering in the Kreb's cycle, will be transformed in Lactate through the enzyme lactate dehydrogenase, and NAD+ will be produced

3.9. How are photosynthesis and cellular respiration related?

3.9.1. The relationship between photosynthesis and cellular respiration is such that the products of one process are the reactants of the other. Photosynthesis is the process whereby carbon dioxide and water react, using energy from sunlight, to produce glucose and oxygen. In cellular respiration, the glucose combines with oxygen to produce carbon dioxide. They are both related because in the formulas they have the first part the same, but once everything starts working the second part of the formula is different.

3.10. What molecule represents energy produced in cellular respiration?

3.10.1. ATP molecule represents energy produced in cellular respiration.

3.11. What is the ultimate source of energy that fuels BOTH of these processes?

3.11.1. (Sun) Energy/Light is the ultimate source of energy that fuels both photosynthesis and cellular respiration.

4. Cells and Biochemistry

4.1. What are the levels of organization? Explain each level and how it differs from the others

4.2. What is the smallest level of organization that can perform life functions?

4.2.1. Cells are the smallest level of organization that can perform life functions.

4.3. What are the characteristics of life? Give an example of each.

4.3.1. The characteristics of life include: made of one or more cells ( plants contain millions of cells within them ), displays organization ( our organ system ), grows and develops ( from a tadpole to a frog ), reproduce ( dogs make puppies ), responds to stimuli (squirrel running away from a dog), requires energy ( humans eat food for energy ), maintains homeostasis ( shivering when cold ), adaptations evolve over time ( cactus’ being able to survive in a low-water environment in the heat ).

4.4. Explain how a rock cannot be considered alive.

4.4.1. A rock cannot be considered alive because it does not qualify with all the characteristics of life, therefore not alive.

4.5. What is a monomer?

4.5.1. A monomer is a molecule that can be bonded to other identical molecules to form a polymer.

4.6. What is a polymer?

4.6.1. A polymer is a substance that has a molecular structure consisting chiefly or entirely of a large number of similar units bonded together.

4.7. What is the reaction that forms polymers?

4.7.1. A polymer is a substance that has a molecular structure consisting chiefly or entirely of a large number of similar units bonded together, e.g., many synthetic organic materials used as plastics and resins.

4.8. What is the reaction that breaks polymers?

4.8.1. Hydrolysis is the process in which polymers break “to break with water”.

4.9. What are the four types of biological molecules (macromolecules) discussed in class?

4.9.1. There are four major types of biological macromolecules include carbohydrates, lipids, proteins, and nucleic acids.

4.10. What are the monomers for each of the types of biological molecules listed above?

4.10.1. Carbohydrates - monosaccharides, Lipids - glycerol and fatty acids, Nucleic acids - nucleotides, Proteins - amino acids.

4.11. Explain the importance of surface area to volume ratio for a cell

4.11.1. The volume to ration has to be modified, it cannot be too small or too large. If it is too large then it will have trouble transferring proteins and nutrients. When it gets too large, the cell either has to divide, or make itself smaller.

4.12. Which cell would be most efficient at absorbing nutrients? A cell with a 8:1 surface area to volume ratio or a cell with a 5:1 surface area to volume ratio? Why?

4.12.1. A cell with a 5:1 ratio would be more efficient at absorbing nutrients because it is smaller and can deliver nutrients all over whereas a cell with a 8:1 surface area to volume ratio will have difficulties spreading the nutrients everywhere due to its higher surface area and volume.

4.13. Which elements (types of atoms) are found in abundance in living organisms?

4.13.1. Elements, or types of atoms, found in many living organisms include protons, neutrons, and electrons. Also, water is the most abundant substance in cells

4.14. Which element is important when considering if something is “organic”?

4.14.1. Carbon