Mercury biosorption enhanced by bacterial cells

1. 1.MATERIALS AND METHODS

1.1. Strains, plasmids, media and general procedures

1.1.1. The strains used were E. coli strain JM109 {Δ (lac-proAB) glnV44 e14-gyrA96 recA1 relA1 endA1 thi hsdR17 [F 'traD36 proA + B + lacI q Δ (lacZ) M15]} was used in this study

2. 2. INP-MerR fusion construction

2.1. The INP-MerR fusion resulted and was obtained constructed as follows. The merR fragment was amplified by PCR using plasmid pT7KB (5) with the primers merR1 (5 'CCGGGATCCTATGGAAAACAATTTGGAGA 3') and merR2 (5 'CAGCTGCAGCCCTAAGGCATAGCCGAACC 3')

3. 3. Cell fractionation

3.1. It was obtained by passing the cells through a press, these juices were centrifuged purified and obtaining the extract called beckman

4. 4. Western Blot Analysis

4.1. The resulting samples are boiled for 10 min, processed in electrophoresis gel, incubated with antibodies to obtain the protein

5. The MerR metalloregulatory protein has the ability to eliminate 6 times more mercury than in local bacteria

5.1. It is intended to eliminate Hg (II) by biosorbents generated by the bacterium Escherichia coli

6. 5. Immunofluorescence microscopy

6.1. The incubated cells are taken to a saline suspension where they are washed, they go back to incubation at 4 degrees Celsius and they pass to microscopy for fluorescence microscopy photography

7. 6. Mercury binding experiments

7.1. the cultures obtained, after the previous steps will determine the amount of Hg (II), this was extracted and analyzed by spectrophotometry, obtaining satisfactory results of said Escherichia coli strain cells